Week 7

Hi guys!

I can’t believe it’s already week 7—time flies fast when you’re having fun, I guess!

This week, I continued searching for primers to add to my training data, and I’ve been expanding the scope of the primers and resources I’ve been looking into to help identify and categorize primers more effectively. I realized something that I haven’t been talking about is the process in which I am finding these primers. 

Typically, I look for common biomarkers of different diseases (ex. SEPTIN9 for colorectal cancer) and find previously created primers on PrimerBank, a database of experimentally validated PCR primers. Because these primers have been used in multiple settings and the sensitivity of the primers are not listed in PrimerBank, I paste the primer sequence (ex. GCAGAGCGGCTTGGGTAAAT) into the search engine of Google Scholar or PubMed to find papers in which this specific primer sequence has been reported, as published studies would typically provide a sensitivity/specificity value. I then open almost every paper associated with this primer sequence and search for their sensitivity/specificity value. Though these attempts are often fruitless, they provide me with an opportunity to learn about different projects and the diverse diagnostic contexts in which these primers are used.

Other than primer selection, I’ve been organizing the layout of my model, as well as thinking through how I want to structure the input features and performance labels for training.

I hope that my explanation was able to give you guys a bit more insight on the primer selection process! The work is extremely laborious but it’s the backbone of this entire project.

See you all next time 🙂 I’m excited to share more with you all!